|
mRNA Vaccines Actually are "Gene
Therapy", Study Shows
A new study is out: Intracellular
Reverse Transcription of Pfizer BioNTech COVID-19 mRNA Vaccine BNT162b2 In
Vitro in Human Liver Cell Line.
What it is saying is: lab studies show
that mRNA vaccine DOES integrate itself into human cellular DNA. This
means that a shot of Pfizer vaccine, taken even once, permanently changes the
DNA of affected cells. For over a year, our trusted “heath experts
and fact checkers” kept telling us the opposite:
However, the bombshell article from Current Issues of Molecular Biology
shows the opposite.
Details
What the article shows is that in vitro,
using a human liver cell line, Pfizer mRNA vaccine uses a natural reverse
transcriptase enzyme called LINE-1, and the genetic code of the vaccine is
reverse transcribed into the DNA.
It also explains that vaccine mRNA actually
does travel to the liver as one of the preferred sites (the other sites, as
we heard, are ovaries and more).
What does it mean? Normally, our cells do
the reverse: the cell nucleus, where the DNA is, expresses certain DNA code
based on conditions of the cell, and produces natural, human messenger RNA.
That messenger RNA travels out of the nucleus, where it is expressed into
proteins needed for cell building. This is how growing organisms express
different genetic programs to grow muscle cells or brain cells, etc.
This process is called “transcription”.
For many years, Central Dogma of
Molecular Biology stated
that the “reverse transcription” — moving genetic code from RNA back into the
sacred cellular nuclear and recoding the DNA — was impossible. Eventually,
scientists realized that it is possible under various conditions. For
example, the HIV RNA virus is able to do so and it reprograms our DNA to
produce copies of it. HIV is the virus that causes AIDS.
To effect reverse transcription, enzymes
called “reverse transcriptases” are needed. One of them is called LINE-1.
Apparently, per study, the Pfizer mRNA
vaccine causes cells to produce that LINE-1 enzyme.
After seeing LINE-1 reverse transcriptase
rise, they tested for alterations to the DNA, making sure they are not
picking up the RNA instead.
The genetic code that they picked up is:
CGAGGTGGCCAAGAATCTGAACGAGA
GCCTGATCGACCTGCAAGAACTGGGGAAGT
ACGAGCAGTACATCAAGTGGCCCTGGTACA
TCTGGCTGGGCTTTATCGCCGGACTGATTG
CCATCGTGATGGTCACAATCATGCTGTGTT
GCATGACCAGCTGCTGTAGCTGCCTGAAGG
GCTGTTGTAGCTGTGGCAGCTGCTGCAAGT
TCGACGAGGACGATTCTGAGCCCGTGCTGA
AGGGCGTGAAACTGCACTACACATGATGAC
TCGAGCTGGTACTGCATGCACGCAATGCTA
GCTGCCCCTTTCCCGTCCTGGGTACCCCGA
GTCTCCCCCGACCTCGGGTCCCAGGTATGC
TCCCACCTCCACCTGCCCCACTCACCACCT
CTGCTAGTTCCAGACACCTCCCAAGCACGC
AGCAATGCAGCTCAAAACGCTTAGCCTA
Anyone wants to run BLAST on it?
Cancer Code
Considering that Sars-Cov-2 “spike protein”
has cancer code from Moderna 2017’ patent 9,587,003, it is imperative to find
out the implications of this reverse transcription, and whether the
vaccinated now have any undesirable genetic code embedded into their DNA.
Of particular interest is whether this
mRNA-induced reverse transcription affects the “germ line”, such as eggs and
sperm cells, and whether it also affects the fetus of pregnant mothers.
Igor’s Newsletter
Moderna Patented
CANCER GENE is in Sars-Cov-2 "Spike Protein"
I did a little bit more digging into the topic of my article about
genes from 2018 Moderna patent. I wrote about it yesterday, but kept reading
and digging and found much more disturbing stuff than I expected. First, a
recap: Sars-Cov-2 virus has a genetic insert that exists ONLY in Moderna…
Read more
3 days ago · 189 likes · 256 comments · Igor Chudov
Please repost this article far and wide due
to its big implication for our public health.
If you liked this post from Igor’s Newsletter, why not share it?
 Share
|
