Worst Fears Realized: Pfizer mRNA Integrates into your DNA

 

mRNA Vaccines Actually are "Gene Therapy", Study Shows gor Chudov Feb 25 A new study is out: Intracellular Reverse Transcription of Pfizer BioNTech COVID-19 mRNA Vaccine BNT162b2 In Vitro in Human Liver Cell Line. What it is saying is: lab studies show that mRNA vaccine DOES integrate itself into human cellular DNA. This means that a shot of Pfizer vaccine, taken even once, permanently changes the DNA of affected cells. For over a year, our trusted “heath experts and fact checkers” kept telling us the opposite: However, the bombshell article from Current Issues of Molecular Biology shows the opposite. Details What the article shows is that in vitro, using a human liver cell line, Pfizer mRNA vaccine uses a natural reverse transcriptase enzyme called LINE-1, and the genetic code of the vaccine is reverse transcribed into the DNA. It also explains that vaccine mRNA actually does travel to the liver as one of the preferred sites (the other sites, as we heard, are ovaries and more). What does it mean? Normally, our cells do the reverse: the cell nucleus, where the DNA is, expresses certain DNA code based on conditions of the cell, and produces natural, human messenger RNA. That messenger RNA travels out of the nucleus, where it is expressed into proteins needed for cell building. This is how growing organisms express different genetic programs to grow muscle cells or brain cells, etc. This process is called “transcription”. For many years, Central Dogma of Molecular Biology stated that the “reverse transcription” — moving genetic code from RNA back into the sacred cellular nuclear and recoding the DNA — was impossible. Eventually, scientists realized that it is possible under various conditions. For example, the HIV RNA virus is able to do so and it reprograms our DNA to produce copies of it. HIV is the virus that causes AIDS. To effect reverse transcription, enzymes called “reverse transcriptases” are needed. One of them is called LINE-1. Apparently, per study, the Pfizer mRNA vaccine causes cells to produce that LINE-1 enzyme. After seeing LINE-1 reverse transcriptase rise, they tested for alterations to the DNA, making sure they are not picking up the RNA instead. The genetic code that they picked up is: CGAGGTGGCCAAGAATCTGAACGAGA GCCTGATCGACCTGCAAGAACTGGGGAAGT ACGAGCAGTACATCAAGTGGCCCTGGTACA TCTGGCTGGGCTTTATCGCCGGACTGATTG CCATCGTGATGGTCACAATCATGCTGTGTT GCATGACCAGCTGCTGTAGCTGCCTGAAGG GCTGTTGTAGCTGTGGCAGCTGCTGCAAGT TCGACGAGGACGATTCTGAGCCCGTGCTGA AGGGCGTGAAACTGCACTACACATGATGAC TCGAGCTGGTACTGCATGCACGCAATGCTA GCTGCCCCTTTCCCGTCCTGGGTACCCCGA GTCTCCCCCGACCTCGGGTCCCAGGTATGC TCCCACCTCCACCTGCCCCACTCACCACCT CTGCTAGTTCCAGACACCTCCCAAGCACGC AGCAATGCAGCTCAAAACGCTTAGCCTA Anyone wants to run BLAST on it? Cancer Code Considering that Sars-Cov-2 “spike protein” has cancer code from Moderna 2017’ patent 9,587,003, it is imperative to find out the implications of this reverse transcription, and whether the vaccinated now have any undesirable genetic code embedded into their DNA. Of particular interest is whether this mRNA-induced reverse transcription affects the “germ line”, such as eggs and sperm cells, and whether it also affects the fetus of pregnant mothers. Igor’s Newsletter Moderna Patented CANCER GENE is in Sars-Cov-2 "Spike Protein" I did a little bit more digging into the topic of my article about genes from 2018 Moderna patent. I wrote about it yesterday, but kept reading and digging and found much more disturbing stuff than I expected. First, a recap: Sars-Cov-2 virus has a genetic insert that exists ONLY in Moderna… Read more 3 days ago · 189 likes · 256 comments · Igor Chudov Please repost this article far and wide due to its big implication for our public health. Like Comment Share If you liked this post from Igor’s Newsletter, why not share it? Share